Please use this identifier to cite or link to this item:
http://ri.uaemex.mx/handle20.500.11799/109102| Title: | Body Mass Index in Pregnancy Does Not Affect Peroxisome Proliferator-activated Receptor Gamma Promoter Region (-359 to -260) Methylation in the Neonate | Keywords: | Body mass index;Methylation;Peroxisome proliferator‑activated receptor gamma;Pregnancy;info:eu-repo/classification/cti/3 | Publisher: | Wolters Kluwer | Project: | 6 1 |
Description: | Background: Obesity in pregnancy can contribute to epigenetic changes. Aim: To assess whether body mass index (BMI) in pregnancy is associated with changes in the methylation of the peroxisome proliferator‑activated receptor γ (PPAR) promoter region (−359 to − 260) in maternal and neonatal leukocytes. Subjects and Methods: In this matched, cohort study 41 pregnant women were allocated into two groups: (a) Normal weight (n = 21) and (b) overweight (n = 20). DNA was extracted from maternal and neonatal leukocytes (4000–10,000 cells) in MagNA Pure (Roche) using MagNA Pure LC DNA Isolation Kit 1 (Roche, Germany). Treatment of DNA (2 μg) was performed with sodium bisulfite (EZ DNA Methylation‑Direct™ Kit; Zymo Research). Real‑time quantitative polymerase chain reaction (qPCR) was performed in a LightCycler 2.0 (Roche) using the SYBR® Advantage® qPCR Premix Kit (Clontech). The primers used for PPARg coactivator (PPARG) M3 were 5’‑aagacggtttggtcgatc‑3’ (forward), and5’‑cgaaaaaaaatccgaaatttaa‑3’ (reverse) and those for PPARG unmethylated were: 5’‑gggaagatggtttggttgatt‑3’ (forward) and 5’‑ttccaaaaaaaaatccaaaatttaa‑3’ (reverse). Intergroup differences were calculated using the Mann–Whitney U‑test, and intragroup differences, with the Wilcoxon test (IBM SPSS Statistics for Windows, Version 19.0. Armonk, NY: IBM Corp.). Results: Significant differences were found in BMI, pregestational weight, and postdelivery weight between groups but not in the methylation status of the PPARγ promoter region (−359 to − 260). Conclusion: The PPARγ promoter region (−359 to − 260) in peripheral leukocytes is unlikely to get an obesity‑induced methylation in pregnancy. Acknowledgments Authors thank the National Council of Science and Technology (CONACYT), México, for the MSc. Scholarship awarded to Ruth Elizabeth Casamadrid Vázquez and Maggie Brunner M.A., for her excellent help with the English style correction. Financial support and sponsorship National Council of Science and Technology (CONACYT), Mexico and Asociación Científica Latina A.C (ASCILA). |
URI: | http://ri.uaemex.mx/handle20.500.11799/109102 | Other Identifiers: | http://hdl.handle.net/20.500.11799/109102 | Rights: | info:eu-repo/semantics/openAccess http://creativecommons.org/licenses/by-nc-nd/4.0 |
| Appears in Collections: | Producción |
Show full item record
Google ScholarTM
Check
Items in DSpace are protected by copyright, with all rights reserved, unless otherwise indicated.